There's supposedly a special building slot. 14 Faction 4. mll. primary_spouse. I tried to save the targets under one scope "scope:actor_spouses": scope:actor = { every_spouse = { save_scope_as = actor_spouses } } So this is how I add the. event_scopes. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . New comments cannot be posted. 4. Note that there are two different things that the game calls "modifier". Here is the intro to an event - the biographer scope works and appears in the event later and in the localization. Type "explorer" to get the explorer window up. CK3 Scope Overview Chart. } Saved scopes will stay saved within the current code chain. Ask modding questions here. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . For CK3 we wanted to open all of that up to go through one unified character interaction system, so every action goes through our script system now. Legacy Wikis. 8. } Saved scopes will stay saved within the current code chain. 4. CK3 and something like Bannerlord are kind of interchangeable. inherit = yes/no/{ <triggers> } # Position will be inherited by the primary heir if that character is valid to hold the position. Eventually, she even converted to his far away faith even. Yes numbers and bools etc. for Stellaris this can be one of: "C:Users ameParadox InteractiveStellaris". Modding,. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Localisation files are saved with . Like @Karlington said above, there is no one right answer for child education in CK3. Covid happened wich greatly delayed RC, both CK2 and EU4 had quite a bunch of early DLCs but most of them were shorter in scope when compared to CK3's DLCs, some of those tagged as "expansions" like sunset invasion were a small event without much change to the overall game. Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3. . lolCrusader Kings. Use GitHub file history feature to compare_versions. ex a vengeful person should move mountains to get revenge etc. 0, generated via automated export from the game files. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . To get to vanilla dutch, you'd need to spawn it somehow and convert to it in CK3,which is beyond the scope of help I can give you. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 0. mother = scope:other_character. } Saved scopes will stay saved within the current code chain. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . These are the color-coded direct scopes as of 1. 2_code. 4. These are the color-coded direct scopes as of 1. 8. There is a yearly_global_pulse which is fired one on Jan 1st every year and has no scope set as root or any saved scopes, that can be used as a master caller to run maintenance effects and trigger events. dds files for textures, which are saved inside the game/gfx/ folder. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . But I am unable to get the game to notice the biography_subject scope. The core [`Scopes`] type which tracks our knowledge about the types of in-game values. Here is the intro to an event - the biographer scope works and appears in the event later and in the localization. Some of the most popular CK3 console commands include: help – This command will show you a list of all available console commands. . CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Harris Sep 14, 2020 @ 5:48pm. 0. Main changes: -) Moderate increased fertility in general - but also decreasing faster by age. 4. This should solve empires sticking around forever as micro-realms. 4. Marriage Mod Creation? Grand Admiral Edward. Read Colorado Springs Gazette Telegraph Newspaper Archives, Dec 1, 1996, p. Converter tries to alter the map as little as possible against vanilla. This page was last edited on 18 October 2020, at 17:45. These are the color-coded direct scopes as of 1. Age of Wonders 4 Empire of Sin Cities: Skylines 2 Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Hunter:. . Every single time my character lives past 65 with no. 0 - 100. 4, generated via automated export from the game files. Crusader Kings. net and assigning them to in-game cultures. . are a scope type, it has its pros and cons. 11. mother = scope:other_character. 4 Army 4. 8. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 7 Combat 4. Converter tries to alter the map as little as possible against vanilla. 0, generated via automated export from the game files. 5LENGTH: 10. (CK3) Help Hi all, I'm just curious if there's a way that I can occupy a province in a war using console commands, or find a console command to end a war (as a secondary participant) on my behalf? I haven't had any luck with the internet, so I just wanted to ask to make sure if it even exists. I suggest to make it a new, bigger role in CK3 - Executioner, a minor title that makes a certain character in charge of executions that you order. These are the color-coded direct scopes as of 1. 7 Combat 4. The supported target is the value that can be passed to it. character behaviors. Legacy Wikis. CK3 Wiki Active Wikis. 4, generated via automated export from the game files. 0. Date/TimeThis is a compatibility patch for mods "CK3 Human Phenotype Project" and "Ethnicities & Portraits Expanded," updated for version 1. mother = scope:other_character. Events belong in a . 4, generated via automated export from the game files. Whether you're a returning player from a previous Crusader Kings title or a first time player of the franchise, this. 8 CombatSide 4. trigger = { root. This article is timeless and should be accurate for any version of the game. e. mother = scope:other_character. . Global commands can be used anywhere, like GetPlayer (returns the player character) or GetCurrentDate. These are the color-coded direct scopes as of 1. braze. god – And This command will give you God mode, which will make you invulnerable to all damage. playing until 476 or so and converting to CK3 with a late antiquity/migration period mod (conveniently, WtWSMS is going to have a CK3 successor:. Use DNA String code to change selected character must installed Cheat Engine and download ck3_1. Enable the set_father = target effect to accept targets regardless of sex, to facilitate adoption code. What exactly are you trying to do? Most events you can just type "event 64025 163109", where "64025" is the event ID, and "163109" is the char ID. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 4. g. These are the color-coded direct scopes as of 1. Thank 常白 !! Let just keep it here as a legacy for people who don't like 1. These are the color-coded direct scopes as of 1. 4. These are the color-coded direct scopes as of 1. (only for alerts)","random_alert_usurpable_title = { limit = { } (optional) weight = { mtth } }","Supported Scopes: character","Supported Targets: landed title","","-----","","random_ally - Iterate through all allies","random_ally = {. What should I need to wrote in the console in order to succeed. 8. Age of Wonders 4 Empire of Sin Cities: Skylines 2 Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Hunter: The Reckoning Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3. faction_leader`. ? History (for CK3): Are spouses, employers, and lieges alive on the relevant dates? Is no one their own grandfather? Special: rivers. In this first video One Proud Bavarian will help us understand the gallery of characters that we will play and what they are made of!. Jul 15, 2021. These are the color-coded direct scopes as of 1. It would look like "c_163109 = { #put your script/event here}". 4. These are the color-coded direct scopes as of 1. 4, generated via automated export from the game files. (CK3) Should you be able to use intrigue to take. 3D models. ## Scope The aim of this mod is to deliver a grand strategy experience to CK3 players within the Elder Scrolls universe created by. CK3 Scope Overview Chart. 4. However we will only move within our scope of 2E 440 to 2E 896. Contents 1 Uses 1. 4. Age of Wonders 4 Empire of Sin Cities: Skylines 2 Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Hunter: The Reckoning Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3. Localisation files are saved with . Default: no. But its what we knew and came to love. any_mercenary_band = { # This limits the scope to a mercenary company which has the title name "d_new_merc". {"payload":{"allShortcutsEnabled":false,"fileTree":{"":{"items":[{"name":"compare_versions","path":"compare_versions","contentType":"directory"},{"name":"1. Scopes always have a bracketed block on the right side: <scope_name> = { #Stuff to execute in the scope. It is opposed to static history modding, though some scripts may exceptionally be triggered from history files. This article is timeless and should be accurate for any version of the game. These are the color-coded direct scopes as of 1. trigger = { root. From CK3 Wiki. The list is incomplete, i checked game files, and there is a lot of scopes that do not show on wiki. 3 Activity 4. Purely a military start with your unique horsemen having the best pursuit stat in the game, so enemy stacks run away from you only having 3 people or so left. } Saved scopes will stay saved within the current code chain. ago. Age of Wonders 4 Empire of Sin Cities: Skylines 2 Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Hunter:. Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3. You will want to have different criteria as well as a scope smaller than global. Add a set_mother = target effect,. I know for a FACT that you can use "if" commands in March of the Eagles, because some of the vanilla events for march of the eagles have it. Will there be a documentation of all the available conditions, commands, scopes etc. 4 Army 4. After learning how to use Visual Studio Code's very helpful CWTools extension (thanks folks!) to browse CK3's code, I found the actual formula to decide how many kids you get. 18; 5; 3;. Aside from receiving a significant makeover, the CK 3 map also features a few new territories. 4, generated via automated export from the game files. An empty trigger is treated as 'no'. Adds [regiment id] of of men-at-arms to [character id], if no character is specified then the player character. These are the color-coded direct scopes as of 1. Crusader Kings is a historical grand strategy / RPG game series for PC, Mac, Linux, PlayStation 5 & Xbox Series X|S developed & published by Paradox Development Studio. CK3 guide: Beginner tips to get you started CK3 Intrigue: Become a master of the dark arts. After starting Maya, you go into Plug-in Manager, and activate pdx_exporter. 2_code. 0 range) end_scheme:flowmapGen. For now the Imperator republics will be converted to the unplayable CK3. Added a Game Rule (Empire Obscurity) that makes empires that control below 20% of their De Jure counties be destroyed. . In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. Works for both Crusader Kings 3 and Imperator: Rome. 0 unless otherwise noted. Haesteinn and Halfdan are both fun 867 starts. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . About this mod. Marriage Mod Creation? Grand Admiral Edward. These are the color-coded direct scopes as of 1. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Age of Wonders 4 Empire of Sin Cities: Skylines 2 Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Hunter: The Reckoning Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3. 4, generated via automated export from the game files. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. LAST UPDATED CK3 VERSION 1. Engage in courtly intrigue, dynastic struggles, and holy warfare in mediæval Europe, Africa, the Middle East, India, the steppes and Tibet. Scopes. EK2 is a Member of the CK3 Co-Op [discord. mother = scope:other_character. These are the color-coded direct scopes as of 1. Don't get me wrong I know living to your 70s and 80s wasn't unheard of back in the middle ages, but it's way too common in CK3, for instance average lifespan was 31 in medieval England, I know child mortality contributed to that statistic but I'll get to that later. Click the character's name/tag under the "Key" column. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 3. Crusader Kings III uses 3d models to represent objects in the game such as portraits, units and holdings, as well as map objects such as trees. } Saved scopes will stay saved within the current code chain. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . trigger = { ROOT = { province = 1 } } immediate = { # This scopes to all mercenary company titles in the game. Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3. yml extension in the localization/ folder and should be encoded as UTF-8 with BOM. mother = scope:other_character. 0, generated via automated export from the game files. mother = scope:other_character. } Saved scopes will stay saved within the current code chain. This will also work with all modded maps. 3 Activity 4. The CK3 Human Phenotype Project is a mod aimed at making the appearences of characters more realistic and diverse by replicating various phenotypes found on the website humanphenotypes. trigger = { ROOT = { province = 1 } } immediate = { # This scopes to all mercenary company titles in the game. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 4. } Saved scopes will stay saved within the current code chain. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . Note that in some cases there may be no root, so make sure your first check is a fallback for "NOT = { exists = this }" if you add dynamic names, descs, or icons. 11. Scopes are used in scripting to select entities in order to check for. It isn't too far out of scope, we plan a 1356 start also, the largest problem is the entire mechanics of the Holy Roman Empire changes in 1356 - but. mother = scope:other_character. Thanks to Terrapass for the image banner. Small county at the bottom of Sweden. you can use "c_char#" as the scope. The primary goal of the project is to increase the depth of the game's map so that less-powerful dynasties see. Army spawning. ) There are two, completely independent ways to get pregnant. Note that in some cases there may be no root, so make sure your first check is a fallback for "NOT = { exists = this }" if you add dynamic names, descs, or icons. Trigger scope: council owner character. CK3 Wiki Active Wikis. Modding,. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . mother = scope:other_character. The primary goal of the project is to increase the depth of the game's map so that less-powerful dynasties see. Your traits + Executioner traits decide all possible methods of doing it (+those decided by tech sometimes, like launchings. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 2. trigger = { root. Recipient's direct liege is you. joined_faction. 2 ActiveCouncilTask 4. trigger = { root. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . } Saved scopes will stay saved within the current code chain. - GitHub - OldEnt/crusader-kings-3-triggers-modifiers-effects-event-scopes-targets-on-actions-code-revisions-list: List of Crusader Kings III triggers, modifiers, effects, event scopes, event targets, on actions, code revisions and setup. 8 CombatSide 4. Robin's Enhanced Details and History expands the game world by increasing the level of detail, specifically through the addition of provinces, complete with new titles, characters, and coats of arms from history. Reply. Realm bonuses include bonuses to men-at-arms and. What you'd want to do instead is scope to the spouse of root, which you do with root. Supported scopes is basically the left half of the effect, so if you call a "set_county_culture" against a ruler, it won't work, since that effect is only scoped to landed titles and you would need to instead use the "set_culture" effect, which has a supported scope for characters. CK3 Wiki Active Wikis Age of Wonders 4 Empire of Sin Cities: Skylines Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3CK3 Wiki Active Wikis. This article is timeless and should be accurate for any version of the game. then simply use the create_alliance effect/command with that saved scope as the target. 4, generated via automated export from the game files. 21 ScriptedGui 4. It works with random scopes. 8. on release? There is a script_docs console command which outputs all triggers, effects, scope types, event target links, modifiers, and on actions to log files. From the rugged Manchurian frontier in the north to the western edges of Papua in the south, this mod provides an immersive and vast world for players. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 11. Member the -= Paradox Game Converters =- TeamCK3 Modding #1 -Brief introduction to modding. If on linux, install libcurl3. Modding,. 11 bookmarkFirst, congratulations. Crusader Kings. trigger = { root. You're in luck! There's a modding wiki and no tutorial and poor documentation. Legacy Wikis. 4, generated via automated export from the game files. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. If the scope of these bonuses is limited to the direct holder why not saying "domain effect", domain seem to refer to all land directly held by one character so it fits. } Saved scopes will stay saved within the current code chain. scope:actor = {has_perk = befriend_perk}} modifier = { # Prefer seducing if you've got the focus for. A new window called "Object Inspector" should appear. Every child in the entire game. 4. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. yml extension in the localization/ folder and should be encoded as UTF-8 with BOM. CK3 Wiki Active Wikis. 10 Culture 4. 23 TopScope 4. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 0 See `event_targets. Being a busy and dedicated man, she lived amongst books until her father recruited a scholar to teach her. CK3's user interface (UI) is highly moddable, but for this reason UI mods change the checksum, to prevent cheating and desyncing in multiplayer. 1 ActiveCasusBelli 4. mother = scope:other_character. 8. . gui_name = { scope = character # the root scope, i. Member the -= Paradox Game Converters =- TeamCK3 Modding #1 -Brief introduction to modding. Enter part of the name to find the character whose house you want to change. 0 See event_targets. These are the color-coded direct scopes as of 1. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . At least some were last verified for version 1. These are the color-coded direct scopes as of 1. 0, generated via automated export from the game files. In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. 5 Artifact 4. Legacy Wikis. If on linux, possibly follow these instructions. Localization refers to the text presented to the player in events, menus, decisions, UI, and any other string of text in any window in the game. I. CK2 Cultures Reborn, a CK3 mod (OUTDATED) Do you miss Arberian, Carantanian, Coptic, Crimean Gothic, and Dalmatian from CK2? You can now find them. These are the color-coded direct scopes as of 1. Hi, I am having problem while running the code: qiime cutadapt trim-paired --i-demultiplexed-sequences demux. Hi everyone, I am struggling to understand how CK3 uses event scopes, as I am too used to Ck2 and EU4. Press tilde to enter debug mode. Legacy Wikis. These titles can change from place to place, but their scope generally remains the same. this is dedicated specifically to modding, whereas the CK3 wiki contains all the information about CK3 in general, with a page linked to modding. These are the color-coded direct scopes as of 1. log` from the game data dumps These are scope transitions that can be chained like `root. Trigger scope: council owner character. The problem is that there is no documentation on what is available to the user, which of course if fine if there is some way to learn this by yourself. The trick is to first save the character you want to ally with as a saved scope variable. Learn More Submit Now About . Je n'ai pas finit la traduction c'est pour ça que la traduction est en Alpha voir pré-Alpha. Jump to navigation Jump to search. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . trigger = { root. Fixed a number of duplicate and missing localisations in various languages. Use script_docs and dump_data_types console commands in the game to generate them. Created by Scratchmen. (CK3) Should you be able to use intrigue to take. Lots of farmland. Let's all help each other learn the modding side of things as we enjoy CK3! :) To get us started, here's a tip from the official FAQ: Will there be a documentation of all the available conditions, commands, scopes. So my ck3 when I play and It crashes and i have these errors: [20:13:44][jomini_script_system. Party Scope - Parties are political entities in Republics in the game. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . 8. Personally, if I'm playing as the child myself, I want to increase my chances of having decent personality traits, even if it means a sub-par education trait. Legacy Wikis. mother = scope:other_character. It determines what sort of scope the root is. 4 Dynasty 2. I would like to make an effect in the Run file that restores all missing/wrong traits, but I can't find any scope in the wiki that allows me to target all living characters. These are the color-coded direct scopes as of 1. The root scope is the character. trigger = { root. These are the color-coded direct scopes as of 1. Toggle signature. Engage in courtly intrigue, dynastic struggles, and holy warfare in mediæval Europe, Africa, the Middle East, India, the steppes and Tibet. qza --p-cores 16 --p-adapter-f AAGCTCGTAGTTGAATTTCG --p-adapter-r CCCAACTATCCCTATTAATCAT -. Install this extension. Add progress to the scope scheme. Toggle signature. 4, generated via automated export from the game files. 4. 8. Scripting. 8. As for scope:recipient, that one is probably empty. 0, generated via automated export from the game files. Mr Samuel Streamer (former Roll1D2 Games) guide on useful tools and how-to mod beginner's guide. 8. CK2 has the respect of its long life, its triumphs and failures. Age of Wonders 4 Empire of Sin Cities: Skylines 2 Crusader Kings 3 Europa Universalis 4 Hearts of Iron 4 Hunter: The Reckoning Imperator: Rome Prison Architect Stellaris Surviving Mars Surviving the Aftermath Vampire: The Masquerade Victoria 3. Let's all help each other learn the modding side of things as we enjoy CK3! :) To get us started, here's a tip from the official FAQ: Will there be a documentation of all the available conditions, commands, scopes. 12 Dynasty 4. -) Pregnancies are more risky and is highly depending on age and health-status of becoming mother. CK3 Scope Overview Chart Scopes are used in scripting to select entities in order to check for Triggers or apply Effects . About this mod. Every single character is an individual, living entity that will act. 4. Crusader Kings. This both makes your file smaller over all, and makes it easier to update the. Being a busy and dedicated man, she lived amongst books until her father recruited a scholar to teach her. mother } In CK3, the ability to save and recall scopes has been vastly simplified by the addition of the save_scope_as command, which can save a given scope under a name, to be recalled later: <scope> = { save_scope_as = <scope_name> } scope:<scope_name> = { #Stuff to execute in the scope. CK3 modding: is there a way to save multiple characters under one scope? I've been working on a mod to add a negative opinion modifier to a recipient, the target being multiple spouses. -) Especially the first pregnancy of a woman is more risky. trigger = { root.